circad | circRNAs associated with diseases

hsa_circ_0000069
Gene	STIL	Organism	Human
Genome Locus	chr1:47745912-47748131:-	Build	hg19
Disease	Colorectal Cancer	ICD-10	Malignant neoplasm of rectosigmoid junction (C19)
DBLink	Link to database	PMID	28003761
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	30 paired Colorectal Cancer (CRC) tissues and adjacent noncancerous tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CTACTTCAGGCACAGGTCTTC Reverse CTGACTCACTGGATGAGGACT	Statistics	Fold Change : Upregulated pvalue : p<0.01
Citation
Guo, JN, Li, J, Zhu, CL, Feng, WT, Shao, JX, Wan, L, Huang, MD, He, JD (2016). Comprehensive profile of differentially expressed circular RNAs reveals that hsa_circ_0000069 is upregulated and promotes cell proliferation, migration, and invasion in colorectal cancer. Onco Targets Ther, 9:7451-7458.